Search results

taxonomy: k__Bacteria;p__Proteobacteria;c__Alphaproteobacteria;o__Rhizobiales

sequence: TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGACTTTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTG
More info from dbBact
Present in 0.018052 of samples (63 / 3490)

host_scientific_name (3 significant)
common ontology termscommon ontology terms
Significant enrichment:
host_scientific_name:Dysidea etheria (4/10) (binomial_p=0.000020, ranksum_p=0.000000)
host_scientific_name:Dysidea avara (16/58) (binomial_p=0.000000, ranksum_p=0.000000)
host_scientific_name:Cliona orientalis (7/31) (binomial_p=0.000001, ranksum_p=0.000000)

env_feature (1 significant)
common ontology termscommon ontology terms
Significant enrichment:
env_feature:animal-associated habitat (51/2446) (binomial_p=0.166966, ranksum_p=0.057290)

country (2 significant)
common ontology termscommon ontology terms
Significant enrichment:
country:Portugal (10/179) (binomial_p=0.001678, ranksum_p=0.000100)
country:Spain (23/754) (binomial_p=0.011768, ranksum_p=0.003858)

ALL (48 significant)
Significant enrichment:
host_scientific_name:Dysidea etheria (4/10) (binomial_p=0.000020, ranksum_p=0.000000)
description:Tissue from the marine sponge Dysidea etheria (4/10) (binomial_p=0.000020, ranksum_p=0.000000)
host_taxid:283597.0 (4/10) (binomial_p=0.000020, ranksum_p=0.000000)
description:sponge tissue from Dysidea avara (6/18) (binomial_p=0.000001, ranksum_p=0.000000)
host_scientific_name:Dysidea avara (16/58) (binomial_p=0.000000, ranksum_p=0.000000)
host_taxid:196820.0 (16/58) (binomial_p=0.000000, ranksum_p=0.000000)
host_scientific_name:Cliona orientalis (7/31) (binomial_p=0.000001, ranksum_p=0.000000)
host_taxid:281731.0 (7/31) (binomial_p=0.000001, ranksum_p=0.000000)
collection_timestamp:4/26/13 (4/18) (binomial_p=0.000265, ranksum_p=0.000000)
sampling_site:Ilheu de Sao Roque, Ilha de Sao Miguel, Azores (5/26) (binomial_p=0.000092, ranksum_p=0.000000)
latitude:37.742961 (5/33) (binomial_p=0.000298, ranksum_p=0.000000)
longitude:-25.637972 (5/33) (binomial_p=0.000298, ranksum_p=0.000000)
salinity_ppt:36 (5/46) (binomial_p=0.001419, ranksum_p=0.000004)
collection_timestamp:8/1/13 (7/71) (binomial_p=0.000302, ranksum_p=0.000000)
sampling_site:Caribbean (5/51) (binomial_p=0.002258, ranksum_p=0.000014)
depth:0.5 (5/64) (binomial_p=0.006049, ranksum_p=0.000249)
depth:0 (4/53) (binomial_p=0.015414, ranksum_p=0.001579)
contributor:RodrigoCosta (5/67) (binomial_p=0.007331, ranksum_p=0.000530)
notes:Set1 (6/84) (binomial_p=0.004238, ranksum_p=0.000198)
old_title:TBD (5/78) (binomial_p=0.013637, ranksum_p=0.001887)
physical_specimen_location:Haverford college (4/70) (binomial_p=0.038048, ranksum_p=0.013290)
country:Portugal (10/179) (binomial_p=0.001678, ranksum_p=0.000100)
geo_loc_name:Portugal (10/179) (binomial_p=0.001678, ranksum_p=0.000100)
scientific_order:ClioNot applicableida (8/146) (binomial_p=0.005280, ranksum_p=0.000673)
depth:18 (4/77) (binomial_p=0.050963, ranksum_p=0.026149)
collection_timestamp:1/22/11 (4/79) (binomial_p=0.055041, ranksum_p=0.025872)
depth:20.9 (4/79) (binomial_p=0.055041, ranksum_p=0.025872)
physical_specimen_location:Lopez Lab (5/102) (binomial_p=0.037975, ranksum_p=0.016395)
physical_specimen_location:Thacker Lab (12/251) (binomial_p=0.002285, ranksum_p=0.000240)
collection_timestamp:5/1/14 (7/161) (binomial_p=0.027724, ranksum_p=0.012784)
physical_specimen_location:University of Lisbon, Portugal (5/121) (binomial_p=0.069034, ranksum_p=0.054649)
lane:4 (19/475) (binomial_p=0.001277, ranksum_p=0.000124)
description:field notes available (6/150) (binomial_p=0.055668, ranksum_p=0.036692)
contributor:Schoenberg (6/150) (binomial_p=0.055668, ranksum_p=0.036692)
latitude:42.05 (11/308) (binomial_p=0.025802, ranksum_p=0.014654)
longitude:3.2 (11/308) (binomial_p=0.025802, ranksum_p=0.014654)
depth:10 (25/701) (binomial_p=0.001258, ranksum_p=0.000092)
contributor:Montoya (16/449) (binomial_p=0.008617, ranksum_p=0.002916)
contributor:Thacker (9/285) (binomial_p=0.076105, ranksum_p=0.072714)
country:Spain (23/754) (binomial_p=0.011768, ranksum_p=0.003858)
geo_loc_name:Spain (23/754) (binomial_p=0.011768, ranksum_p=0.003858)
physical_specimen_location:Institute of Marine Sciences (ICM-CSIC) (13/453) (binomial_p=0.070892, ranksum_p=0.066585)
old_title:Not applicable (45/1807) (binomial_p=0.021848, ranksum_p=0.001661)
env_biome:marine benthic biome (47/2151) (binomial_p=0.109269, ranksum_p=0.032841)
emp_status:EMP (48/2281) (binomial_p=0.159676, ranksum_p=0.068531)
host_common_name:sponges (50/2385) (binomial_p=0.160399, ranksum_p=0.056797)
env_feature:animal-associated habitat (51/2446) (binomial_p=0.166966, ranksum_p=0.057290)
water_temperature_degrees_c:Missing: Not provided (49/2357) (binomial_p=0.177401, ranksum_p=0.078012)

View as table